D14Mit95 Primer Detail MGI Mouse MGI:707400

D14Mit95 Primer Detail

Name

D14Mit95
Primer 1 Sequence

TATTTTTAAGTCAGTATACACATGCGC
Primer 2 Sequence

TTATCCAAGTGTATTTAAAGAAGAGGC
ID

MGI:707400
Product Size

124
Other IDs

D14Mit95 (BROAD)
Note

MIT assay: MPC2351
Additional information: MIT STS Marker Data Files

D14Mit95

DNA segment, Chr 14, Massachusetts Institute of Technology 95

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit95	a	169bp	129X1/Sv
Not Specified	D14Mit95	f	125bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D14Mit95	b	smaller than f	C57BL/6J
	c	129bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit95	a	117bp	SPRET/EiJ
	b	125bp	NON/ShiLt
	c	129bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	d	137bp	CAST/EiJ
	e	169bp	DBA/2J, LP/J, NOD/MrkTac

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24