D14Mit94 Primer Detail MGI Mouse MGI:707399

D14Mit94 Primer Detail

Name

D14Mit94
Primer 1 Sequence

ATTCTAGTGCAGAAGTCAGAACACA
Primer 2 Sequence

AGACACAACACACCCGCAT
ID

MGI:707399
Product Size

101
Other IDs

D14Mit94 (BROAD)
Note

MIT assay: MT313
Additional information: MIT STS Marker Data Files

D14Mit94

DNA segment, Chr 14, Massachusetts Institute of Technology 94

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit94	a	largest	JF1, MSM/Ms
		b	smaller	C57BL/6
		c	smallest	DBA/2

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit94	a	79bp	CAST/EiJ
	b	99bp	NON/ShiLt
	c	101bp	DBA/2J
	d	107bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	e	109bp	LP/J, NOD/MrkTac

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24