D14Mit92 Primer Detail MGI Mouse MGI:707397

D14Mit92 Primer Detail

Name

D14Mit92
Primer 1 Sequence

CTGCTGCAGAATTAATTGATTTT
Primer 2 Sequence

GGATATATGGATTTATACAGACACACA
ID

MGI:707397
Product Size

89
Other IDs

D14Mit92 (BROAD)
Note

MIT assay: MPC972
Additional information: MIT STS Marker Data Files

D14Mit92

DNA segment, Chr 14, Massachusetts Institute of Technology 92

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit92	a	90bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
	b	110bp	NOD/MrkTac
	c	128bp	A/J, BALB/cJ, C3H/HeJ
	d	130bp	CAST/EiJ
	e	134bp	AKR/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D14Mit92	a	128bp	AKR/OlaHsd
	c	122bp	A/JOlaHsd, BALB/cJ, C3H/HeJ, C57BL/10
	d	88bp	129P3/J, C57BL/6JOlaHsd, DBA/2J, JF1, SJL/J
	p	114bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23