About   Help   FAQ
D15Mit252 Primer Detail
Primers
  • Name
    D15Mit252
  • Primer 1 Sequence
    CTTCAAACATGTTATCATTGTCACA
  • Primer 2 Sequence
    CTTCTGTATTCACAGGTGCTCG
  • ID
    MGI:707371
  • Product Size
    121
  • Other IDs
    D15Mit252 (BROAD)
  • Note
    MIT assay: MTH2945
    Additional information: MIT STS Marker Data Files
Genes
D15Mit252 DNA Segment, Chr 15 Massachusetts Institute of Technology 252
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit252 a 118bp A/J, BALB/cJ
b 124bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
c 132bp C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NON/ShiLt
d 140bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D15Mit252 a 120bp AKR/OlaHsd, C57BL/6JOlaHsd, C57BL/10, JF1
c 114bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 128bp DBA/2J
p 140bp PWB
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D15Mit252 c larger CBA/Kw
e smaller KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory