About   Help   FAQ
D10Mit148 Primer Detail
Primers
  • Name
    D10Mit148
  • Primer 1 Sequence
    TTCCAGACATACCATCACTATTCTG
  • Primer 2 Sequence
    TTAAGTAGACTCTGTTGCAGAGGTG
  • ID
    MGI:707316
  • Product Size
    132
  • Other IDs
    D10Mit148 (BROAD)
  • Note
    MIT assay: MT1210
    Additional information: MIT STS Marker Data Files
Genes
D10Mit148 DNA segment, Chr 10, Massachusetts Institute of Technology 148
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit148 a 133bp 129X1/Sv
f 135, 137bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit148 a 129bp LP/J, NON/ShiLt
b 133bp BALB/cJ
c 135bp CAST/EiJ, DBA/2J
d 137bp A/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac
e 143bp AKR/J
J:53815 Vacher J, et al., Mamm Genome. 1999 Mar;10(3):239-43
Endonuclease Gene Allele Fragments Strains
D10Mit148 b 0.137kb C57BL/6J, C57BL/10J, C57BR/cdJ, C57L/J
g 0.13kb 129T2/SvEms, GL/Le Ostm1gl/Ostm1gl
m 0.095kb M. m. molossinus
s 0.080kb M. spretus
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:53815 Vacher J, et al., Genetic localization and transmission of the mouse osteopetrotic grey-lethal mutation. Mamm Genome. 1999 Mar;10(3):239-43
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory