About   Help   FAQ
D17Mit175 Primer Detail
Primers
  • Name
    D17Mit175
  • Primer 1 Sequence
    TGGAAATCGGAGCCTCTG
  • Primer 2 Sequence
    TTGGAAAAGGTTGAGAGTAGATCA
  • ID
    MGI:707309
  • Product Size
    109
  • Other IDs
    D17Mit175 (BROAD)
  • Note
    MIT assay: MT4348
    Additional information: MIT STS Marker Data Files
Genes
D17Mit175 DNA segment, Chr 17, Massachusetts Institute of Technology 175
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit175 a 104bp 129X1/Sv
f 104, 113bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit175 a 100bp CAST/EiJ
b 104bp BALB/cJ, DBA/2J, LP/J
c 110bp B6.Cg-Lepob/+, C57BL/6J
d 113bp NOD/MrkTac
e 120bp NON/ShiLt
f 122bp A/J, AKR/J, C3H/HeJ
g 134bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit175 c 120bp CBA/CaOlaHsd
s 118bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit175 a 122bp AKR/W, C3H/W, CBA/W
b 110bp A.CA/W, C57BL/6W, C57BL/10W
c 104bp 129/SvW, BALB/cW, BN/aW, DBA/2W
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory