About   Help   FAQ
D17Mit177 Primer Detail
Primers
  • Name
    D17Mit177
  • Primer 1 Sequence
    CCCTCTCATGATTTAGGACCC
  • Primer 2 Sequence
    AAAGGGCAGGTCACTCAAGA
  • ID
    MGI:707307
  • Product Size
    113
  • Other IDs
    D17Mit177 (BROAD)
  • Note
    MIT assay: MT144
    Additional information: MIT STS Marker Data Files
Genes
D17Mit177 DNA segment, Chr 17, Massachusetts Institute of Technology 177
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit177 b 110bp C57BL/6J
c 116bp BALB/cJ
s 113bp 129X1/SvJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit177 a 100bp NON/ShiLt
b 108bp NOD/MrkTac
c 110bp B6.Cg-Lepob/+, C57BL/6J
d 112bp LP/J
e 116bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
f 120bp CAST/EiJ
g 134bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit177 c smaller C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit177 c 117bp CBA/CaOlaHsd
s 113bp SWR/OlaHsd
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory