About   Help   FAQ
D17Mit173 Primer Detail
Primers
  • Name
    D17Mit173
  • Primer 1 Sequence
    GCACCTGTTTCTCTTCAGGC
  • Primer 2 Sequence
    ATTAAAAGGTGTGCGCCATC
  • ID
    MGI:707303
  • Product Size
    122
  • Other IDs
    D17Mit173 (BROAD)
  • Note
    MIT assay: MT3869
    Additional information: MIT STS Marker Data Files
Genes
D17Mit173 DNA segment, Chr 17, Massachusetts Institute of Technology 173
Polymorphisms
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit173 b 122bp C57BL/6J
s 134bp 129X1/SvJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit173 a 116bp CAST/EiJ
b 120bp A/J, DBA/2J, NOD/MrkTac, NON/ShiLt
c 122bp B6.Cg-Lepob/+, C57BL/6J
d 134bp AKR/J, BALB/cJ, C3H/HeJ
e 142bp SPRET/EiJ
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D17Mit173 c larger CBA/Kw
e smaller KE
References
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory