D18Mit232 Primer Detail MGI Mouse MGI:707286

D18Mit232 Primer Detail

Name

D18Mit232
Primer 1 Sequence

AGTCACAATGATATTAGATCTCACACA
Primer 2 Sequence

TCCCTAAGTAGCCATTTACTGTCC
ID

MGI:707286
Product Size

90
Other IDs

D18Mit232 (BROAD)
Note

MIT assay: MTH2917
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 18, Massachusetts Institute of Technology 232

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D18Mit232	m	94bp	MOLF/EiJ
Not Specified	D18Mit232	s	100bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D18Mit232	a	70bp	CAST/EiJ
	b	90bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	c	94bp	C3H/HeJ, NON/ShiLt
	d	100bp	LP/J

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/09/2025 MGI 6.24