About   Help   FAQ
D2Mit226 Primer Detail
Primers
  • Name
    D2Mit226
  • Primer 1 Sequence
    TTTTTGCAACTTTGTTAAGAATTCC
  • Primer 2 Sequence
    AAAACACCCTCCCACCCTT
  • ID
    MGI:707280
  • Product Size
    101
  • Other IDs
    D2Mit226 (BROAD)
  • Note
    MIT assay: MT1846
    Additional information: MIT STS Marker Data Files
Genes
D2Mit226 DNA segment, Chr 2, Massachusetts Institute of Technology 226
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit226 b 0.102kb C57BL/6
c 0.124kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, BALB/c, BALB/cAnNCr, BALB/cByJ
J:52789 Williamson CM, et al., Genet Res. 1998 Dec;72(3):255-65
Notes: The T26H +/+ + parent is produced from crosses to C3H/HeH and the T26H Gdf5/+Gdf5 parent is produced from crosses to a Harwell stock LL.
Endonuclease Gene Allele Fragments Strains
D2Mit226 b 0.104kb STOCK T(2;8)26H Gdf5bp
t 0.124kb STOCK T(2;8)26H
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit226 a 90bp SPRET/EiJ
b 100bp LP/J
c 102bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
d 106bp NON/ShiLt
e 110bp CAST/EiJ
f 124bp A/J, BALB/cJ, C3H/HeJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D2Mit226 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D2Mit226 a 124bp A.CA/W, BALB/cW, C3H/W, C57BL/10W, CBA/W
b 102bp 129/SvW, AKR/W, BN/aW, C57BL/6W, DBA/2W
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:52789 Williamson CM, et al., Imprinting of distal mouse chromosome 2 is associated with phenotypic anomalies in utero. Genet Res. 1998 Dec;72(3):255-65
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory