About   Help   FAQ
D8Mit35 Primer Detail
Primers
  • Name
    D8Mit35
  • Primer 1 Sequence
    GAGTCCTACAAGTTGTGCCTTG
  • Primer 2 Sequence
    GGAGATAAGGAGACAAGTGTCCC
  • ID
    MGI:707279
  • Product Size
    138
  • Other IDs
    D8Mit35 (BROAD)
  • Note
    MIT assay: A768
    Additional information: MIT STS Marker Data Files
Genes
D8Mit35 DNA segment, Chr 8, Massachusetts Institute of Technology 35
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit35 a 132bp DBA/2J
b 134bp C3H/HeJ
c 138bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, LP/J, NOD/MrkTac, NON/ShiLt
d 150bp CAST/EiJ
e 194bp SPRET/EiJ
J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8
Endonuclease Gene Allele Fragments Strains
D8Mit35 a 0.138kb AEJ/Gn
s 0.194kb M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory