About   Help   FAQ
D12Mit204 Primer Detail
Primers
  • Name
    D12Mit204
  • Primer 1 Sequence
    AGGCTGGAAAGAAGGACCAT
  • Primer 2 Sequence
    TTTTCCCATTTTCCCATTAGG
  • ID
    MGI:707263
  • Product Size
    166
  • Other IDs
    D12Mit204 (BROAD)
  • Note
    MIT assay: MT3847
    Additional information: MIT STS Marker Data Files
Genes
D12Mit204 DNA segment, Chr 12, Massachusetts Institute of Technology 204
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit204 a 156bp CAST/EiJ
b 162bp SPRET/EiJ
c 164bp NOD/MrkTac, NON/ShiLt
d 166bp AKR/J
e 170bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D12Mit204 c 167bp CBA/CaOlaHsd
s 151bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory