About   Help   FAQ
D15Mit174 Primer Detail
Primers
  • Name
    D15Mit174
  • Primer 1 Sequence
    GTGTTCCTTGTGTTTCTTTTTGG
  • Primer 2 Sequence
    GGTCAAGGAGACACTCAGTTCC
  • ID
    MGI:707240
  • Product Size
    126
  • Other IDs
    D15Mit174 (BROAD)
  • Note
    MIT assay: MT3690
    Additional information: MIT STS Marker Data Files
Genes
D15Mit174 DNA segment, Chr 15, Massachusetts Institute of Technology 174
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit174 a 122bp NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 128bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J
c 130bp DBA/2J
d 134bp AKR/J
e 136bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D15Mit174 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit174 c 167bp CBA/CaOlaHsd
s 170bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
12/30/2025
MGI 6.24 		The Jackson Laboratory