About   Help   FAQ
D11Mit219 Primer Detail
Primers
  • Name
    D11Mit219
  • Primer 1 Sequence
    TTGTATGTATAGATGCATTTGAATGG
  • Primer 2 Sequence
    GGTTTGTATAAATTCTCACCTGTGC
  • ID
    MGI:707223
  • Product Size
    132
  • Other IDs
    D11Mit219 (BROAD)
  • Note
    MIT assay: MT3314
    Additional information: MIT STS Marker Data Files
Genes
D11Mit219 DNA segment, Chr 11, Massachusetts Institute of Technology 219
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit219 a 146bp 129X1/Sv
f 130, 146bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit219 a 130bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
b 140bp SPRET/EiJ
c 146bp DBA/2J
d 148bp CAST/EiJ, LP/J
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit219 c 161bp CBA/CaOlaHsd
s 173bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory