About   Help   FAQ
D11Mit212 Primer Detail
Primers
  • Name
    D11Mit212
  • Primer 1 Sequence
    CTCTGGTCTCTCTGTATACATGTGC
  • Primer 2 Sequence
    AGCAACTGGGGCATTTAATG
  • ID
    MGI:707219
  • Product Size
    141
  • Other IDs
    D11Mit212 (BROAD)
  • Note
    MIT assay: MT3191
    Additional information: MIT STS Marker Data Files
Genes
D11Mit212 DNA segment, Chr 11, Massachusetts Institute of Technology 212
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit212 a 142bp SPRET/EiJ
b 144bp B6.Cg-Lepob/+
c 148bp C57BL/6J
d 150bp CAST/EiJ
e 164bp BALB/cJ, NON/ShiLt
f 166bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit212 c 198bp CBA/CaOlaHsd
s 221bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory