About   Help   FAQ
D11Mit214 Primer Detail
Primers
  • Name
    D11Mit214
  • Primer 1 Sequence
    CATACAGCCTTCAACAATGACA
  • Primer 2 Sequence
    ACTGCATACATGTGCACTCATG
  • ID
    MGI:707213
  • Product Size
    148
  • Other IDs
    D11Mit214 (BROAD)
  • Note
    MIT assay: MT2101
    Additional information: MIT STS Marker Data Files
Genes
D11Mit214 DNA segment, Chr 11, Massachusetts Institute of Technology 214
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit214 a 131bp SPRET/EiJ
b 135bp A/J, C3H/HeJ, LP/J
c 147bp BALB/cJ, NON/ShiLt
d 149bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
e 163bp CAST/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D11Mit214 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit214 d 148bp 129P3/J, AKR/OlaHsd, BALB/cJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
l 150bp SJL/J
p 164bp JF1, PWB
w 134bp A/JOlaHsd, C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit214 c 190bp CBA/CaOlaHsd
s 188bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory