About   Help   FAQ
D1Mit303 Primer Detail
Primers
  • Name
    D1Mit303
  • Primer 1 Sequence
    GGTTTCTATTTCGGTTCTCGG
  • Primer 2 Sequence
    TCTGTGCTGCAAAACAGAGG
  • ID
    MGI:707208
  • Product Size
    128
  • Other IDs
    D1Mit303 (BROAD)
  • Note
    MIT assay: MT3244
    Additional information: MIT STS Marker Data Files
Genes
D1Mit303 DNA segment, Chr 1, Massachusetts Institute of Technology 303
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D1Mit303 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit303 a 98bp AKR/J, NOD/MrkTac
b 104bp CAST/EiJ
c 114bp SPRET/EiJ
d 118bp A/J, C3H/HeJ, NON/ShiLt
e 120bp LP/J
f 124bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J
g 130bp BALB/cJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit303 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D1Mit303 b 142bp C57BL/6JOlaHsd
c 128bp BALB/cJ, C57BL/10
d 118bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, DBA/2J, SJL/J
j 134bp JF1
p 104bp PWB
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit303 c 117bp CBA/CaOlaHsd
s 129bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory