D17Mit41 Primer Detail MGI Mouse MGI:707199

D17Mit41 Primer Detail

Name

D17Mit41
Primer 1 Sequence

TGCTTGCTGCTTTCTCAGAA
Primer 2 Sequence

GATCTGCCTGTCTCCTTAGTGC
ID

MGI:707199
Product Size

203
Other IDs

D17Mit41 (BROAD)
Note

MIT assay: B306
Additional information: MIT STS Marker Data Files

D17Mit41

DNA segment, Chr 17, Massachusetts Institute of Technology 41

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit41	a	largest	DBA/2, JF1, MSM/Ms
Not Specified	D17Mit41	b	smaller	C57BL/6

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit41	b	204bp	BALB/cJ, C57BL/6J
Not Specified	D17Mit41	s	220bp	129X1/SvJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit41	a	192bp	SPRET/EiJ
	b	204bp	A/J, AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	c	212bp	CAST/EiJ
	d	220bp	DBA/2J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24