D9Mit182 Primer Detail MGI Mouse MGI:707193

D9Mit182 Primer Detail

Name

D9Mit182
Primer 1 Sequence

GTGAAATTGGTTATGTAAATGTCTGA
Primer 2 Sequence

GAGATGACTAGGGTGAACTGGG
ID

MGI:707193
Product Size

104
Other IDs

D9Mit182 (BROAD)
Note

MIT assay: MT2200
Additional information: MIT STS Marker Data Files

D9Mit182

DNA segment, Chr 9, Massachusetts Institute of Technology 182

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D9Mit182	a	119bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv, CD-1
		b	125bp	129X1/SvJ
		c	117, 119bp	CD-1

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit182	b	smaller	C57BL/6J
	D9Mit182	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit182	a	91bp	SPRET/EiJ
	b	99bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	102bp	CAST/EiJ, NON/ShiLt
	d	110bp	LP/J
	e	115bp	NOD/MrkTac
	f	117bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J
	g	127bp	AKR/J

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D9Mit182	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit182	c	116bp	CBA/CaOlaHsd
	D9Mit182	s	139bp	SWR/OlaHsd

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit182	a	smaller	129P3/J
	D9Mit182	s	larger	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24