About   Help   FAQ
D1Mit65 Primer Detail
Primers
  • Name
    D1Mit65
  • Primer 1 Sequence
    CTAACCCCTATACACATACTGCCC
  • Primer 2 Sequence
    CCGTTCAGACTTGAATACAGACC
  • ID
    MGI:707179
  • Product Size
    180
  • Other IDs
    D1Mit65 (BROAD)
  • Note
    MIT assay: MPC655
    Additional information: MIT STS Marker Data Files
Genes
D1Mit65 DNA segment, Chr 1, Massachusetts Institute of Technology 65
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit65 a 108bp SPRET/EiJ
b 180bp B6.Cg-Lepob/+, C57BL/6J
c 182bp DBA/2J
d 188bp CAST/EiJ
e 212bp A/J, AKR/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
J:66473 Bagella L, et al., J Cell Biochem. 2000 Apr;78(1):170-8
Endonuclease Gene Allele Fragments Strains
D1Mit65 a 0.212kb AEJ/Gn
s 0.108kb M. spretus
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:66473 Bagella L, et al., Genomic organization, promoter analysis, and chromosomal mapping of the mouse gene encoding Cdk9. J Cell Biochem. 2000 Apr;78(1):170-8
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory