About   Help   FAQ
D18Mit34 Primer Detail
Primers
  • Name
    D18Mit34
  • Primer 1 Sequence
    CACTGGATGACACAGCCTGT
  • Primer 2 Sequence
    GATGTTTCCTTGGGTTTGTCA
  • ID
    MGI:707147
  • Product Size
    136
  • Note
    MIT assay: B369
Genes
D18Mit34 DNA segment, Chr 18, Massachusetts Institute of Technology 34
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D18Mit34 c 142bp C3HeB/FeJLe
f smaller FVB/N
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit34 m 150bp MOLF/EiJ
s 152bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit34 a 128bp BALB/cJ
b 134bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
c 138bp A/J, DBA/2J, NON/ShiLt
d 140bp SPRET/EiJ
e 142bp C3H/HeJ
f 156bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D18Mit34 c 135bp CBA/CaOlaHsd
s 133bp SWR/OlaHsd
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D18Mit34 c smaller CBA/Kw
e larger KE
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory