About   Help   FAQ
D18Mit36 Primer Detail
Primers
  • Name
    D18Mit36
  • Primer 1 Sequence
    CTTGTATCCATGAATCCATCCA
  • Primer 2 Sequence
    TTCTTCCATGCTGTATACAAGGC
  • ID
    MGI:707143
  • Product Size
    147
  • Other IDs
    D18Mit36 (BROAD)
  • Note
    MIT assay: A684
    Additional information: MIT STS Marker Data Files
Genes
D18Mit36 DNA segment, Chr 18, Massachusetts Institute of Technology 36
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D18Mit36 m 150bp MOLF/EiJ
s 162bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit36 a 136bp A/J, AKR/J, LP/J, NOD/MrkTac, NON/ShiLt
b 144bp BALB/cJ, C3H/HeJ, DBA/2J
c 150bp C57BL/6J, CAST/EiJ
d 156bp SPRET/EiJ
e 184bp B6.Cg-Lepob/+
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory