D11Mit36 Primer Detail MGI Mouse MGI:707129

D11Mit36 Primer Detail

Name

D11Mit36
Primer 1 Sequence

CCAGAACTTTTGCTGCTTCC
Primer 2 Sequence

GTGAGCCCTAGGTCCAGTGA
ID

MGI:707129
Product Size

232
Other IDs

D11Mit36 (BROAD)
Note

MIT assay: A653
Additional information: MIT STS Marker Data Files

D11Mit36

DNA segment, Chr 11, Massachusetts Institute of Technology 36

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D11Mit36	b	larger than f	C57BL/6J
	c	240bp	C3HeB/FeJLe
	f	smaller than c and b	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit36	a	220bp	DBA/2J
	b	234bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J
	c	236bp	BALB/cJ, NOD/MrkTac, NON/ShiLt
	d	240bp	A/J, C3H/HeJ
	e	242bp	LP/J
	f	302bp	CAST/EiJ
	g	326bp	SPRET/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D11Mit36	a	227bp	AKR/OlaHsd
	b	239bp	C57BL/6JOlaHsd
	c	229bp	BALB/cJ, C57BL/10
	d	213bp	DBA/2J, SJL/J
	j	293bp	JF1
	p	289bp	PWB
	w	235bp	129P3/J, A/JOlaHsd, C3H/HeJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit36	c	241bp	CBA/CaOlaHsd
	D11Mit36	s	219bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24