About   Help   FAQ
D11Mit36 Primer Detail
Primers
  • Name
    D11Mit36
  • Primer 1 Sequence
    CCAGAACTTTTGCTGCTTCC
  • Primer 2 Sequence
    GTGAGCCCTAGGTCCAGTGA
  • ID
    MGI:707129
  • Product Size
    232
  • Other IDs
    D11Mit36 (BROAD)
  • Note
    MIT assay: A653
    Additional information: MIT STS Marker Data Files
Genes
D11Mit36 DNA segment, Chr 11, Massachusetts Institute of Technology 36
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D11Mit36 b larger than f C57BL/6J
c 240bp C3HeB/FeJLe
f smaller than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit36 a 220bp DBA/2J
b 234bp AKR/J, B6.Cg-Lepob/+, C57BL/6J
c 236bp BALB/cJ, NOD/MrkTac, NON/ShiLt
d 240bp A/J, C3H/HeJ
e 242bp LP/J
f 302bp CAST/EiJ
g 326bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D11Mit36 a 227bp AKR/OlaHsd
b 239bp C57BL/6JOlaHsd
c 229bp BALB/cJ, C57BL/10
d 213bp DBA/2J, SJL/J
j 293bp JF1
p 289bp PWB
w 235bp 129P3/J, A/JOlaHsd, C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit36 c 241bp CBA/CaOlaHsd
s 219bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory