About   Help   FAQ
D19Mit33 Primer Detail
Primers
  • Name
    D19Mit33
  • Primer 1 Sequence
    CCTTTTCAAGAGCATCCTTAAA
  • Primer 2 Sequence
    GGTGGGACTTGAGAGATGCA
  • ID
    MGI:707102
  • Product Size
    262
  • Other IDs
    D19Mit33 (BROAD)
  • Note
    MIT assay: MPC214
    Additional information: MIT STS Marker Data Files
Genes
D19Mit33 DNA segment, Chr 19, Massachusetts Institute of Technology 33
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit33 a largest DBA/2
b smaller C57BL/6, JF1
c smallest MSM/Ms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit33 m 250bp MOLF/EiJ
s 237bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit33 a 226bp NON/ShiLt
b 228bp AKR/J, NOD/MrkTac
c 238bp CAST/EiJ
d 252bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 320bp C3H/HeJ, DBA/2J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D19Mit33 c larger CBA/Kw
e smaller KE
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory