D19Mit30 Primer Detail MGI Mouse MGI:707101

D19Mit30 Primer Detail

Name

D19Mit30
Primer 1 Sequence

GGTGGCTTAGAAATAGTATCGAAA
Primer 2 Sequence

CCAGCTCTAGGCAGGCATAT
ID

MGI:707101
Product Size

150
Other IDs

D19Mit30 (BROAD)
Note

MIT assay: B532
Additional information: MIT STS Marker Data Files

D19Mit30

DNA segment, Chr 19, Massachusetts Institute of Technology 30

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit30	a	136bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	130bp	129X1/SvJ
		c	136, 154bp	CD-1

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit30	m	171bp	MOLF/EiJ
Not Specified	D19Mit30	s	185bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit30	a	126bp	SPRET/EiJ
	b	136bp	A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
	c	144bp	CAST/EiJ
	d	152bp	AKR/J, B6.Cg-Lep^ob/+, DBA/2J
	e	154bp	LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D19Mit30	a	152bp	129/SvW, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
	D19Mit30	b	136bp	A.CA/W, BALB/cW, BN/aW

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23