About   Help   FAQ
D19Mit30 Primer Detail
Primers
  • Name
    D19Mit30
  • Primer 1 Sequence
    GGTGGCTTAGAAATAGTATCGAAA
  • Primer 2 Sequence
    CCAGCTCTAGGCAGGCATAT
  • ID
    MGI:707101
  • Product Size
    150
  • Other IDs
    D19Mit30 (BROAD)
  • Note
    MIT assay: B532
    Additional information: MIT STS Marker Data Files
Genes
D19Mit30 DNA segment, Chr 19, Massachusetts Institute of Technology 30
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit30 a 136bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 130bp 129X1/SvJ
c 136, 154bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit30 m 171bp MOLF/EiJ
s 185bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit30 a 126bp SPRET/EiJ
b 136bp A/J, BALB/cJ, NOD/MrkTac, NON/ShiLt
c 144bp CAST/EiJ
d 152bp AKR/J, B6.Cg-Lepob/+, DBA/2J
e 154bp LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D19Mit30 a 152bp 129/SvW, AKR/W, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 136bp A.CA/W, BALB/cW, BN/aW
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory