About   Help   FAQ
D16Mit76 Primer Detail
Primers
  • Name
    D16Mit76
  • Primer 1 Sequence
    TTAAGGAGAAAGTAAAAGATACACACA
  • Primer 2 Sequence
    TATTGTTTTCCTGATCAAACATTTG
  • ID
    MGI:707080
  • Product Size
    88
  • Other IDs
    D16Mit76 (BROAD)
  • Note
    MIT assay: MT504
    Additional information: MIT STS Marker Data Files
Genes
D16Mit76 DNA segment, Chr 16, Massachusetts Institute of Technology 76
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit76 a 89bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J
b 94bp SPRET/EiJ
c 108bp DBA/2J
d 110bp NOD/MrkTac
e 135bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
f 147bp CAST/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D16Mit76 a 87bp AKR/OlaHsd
b 81bp 129P3/J, C57BL/6JOlaHsd, C57BL/10
d 101bp A/JOlaHsd, BALB/cJ, C3H/HeJ, DBA/2J
j 89bp JF1
l 105bp SJL/J
p 97bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory