D16Mit71 Primer Detail MGI Mouse MGI:707075

D16Mit71 Primer Detail

Name

D16Mit71
Primer 1 Sequence

TAGAAAATCTTCAAATAGGATCTGTTC
Primer 2 Sequence

GAGCATTTCCCTTTTACCTGG
ID

MGI:707075
Product Size

154
Other IDs

D16Mit71 (BROAD)
Note

MIT assay: MPC490
Additional information: MIT STS Marker Data Files

D16Mit71

DNA segment, Chr 16, Massachusetts Institute of Technology 71

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D16Mit71	b	smaller than f	C57BL/6J
	c	165bp	C3HeB/FeJLe
	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit71	a	157bp	B6.Cg-Lep^ob/+
	b	159bp	C57BL/6J, CAST/EiJ
	c	163bp	A/J, AKR/J, BALB/cJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	d	165bp	C3H/HeJ
	e	223bp	SPRET/EiJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit71	c	159bp	CBA/CaOlaHsd
	D16Mit71	s	161bp	SWR/OlaHsd

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24