D16Mit79 Primer Detail MGI Mouse MGI:707072

D16Mit79 Primer Detail

Name

D16Mit79
Primer 1 Sequence

ATCCTGCATGCTTTTGCTCT
Primer 2 Sequence

CAGAGGAGAGTTGTCTGTGTTCC
ID

MGI:707072
Product Size

137
Other IDs

D16Mit79 (BROAD)
Note

MIT assay: MTH128
Additional information: MIT STS Marker Data Files

D16Mit79

DNA segment, Chr 16, Massachusetts Institute of Technology 79

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit79	a	145bp	129X1/Sv
Not Specified	D16Mit79	f	151bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit79	a	135bp	B6.Cg-Lep^ob/+, C57BL/6J
	b	137bp	BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	c	145bp	NON/ShiLt
	d	149bp	SPRET/EiJ
	e	151bp	A/J, AKR/J, NOD/MrkTac
	f	159bp	CAST/EiJ

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit79	a	larger	129P3/J
	D15Mit79	s	smaller	SJL/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24