About   Help   FAQ
D7Mit191 Primer Detail
Primers
  • Name
    D7Mit191
  • Primer 1 Sequence
    TTGGGTTTGTACTACCTAGATACCTC
  • Primer 2 Sequence
    CCTCTAGGGCTCTTGCACAC
  • ID
    MGI:707068
  • Product Size
    150
  • Other IDs
    D7Mit191 (BROAD)
  • Note
    MIT assay: MT2216
    Additional information: MIT STS Marker Data Files
Genes
D7Mit191 DNA segment, Chr 7, Massachusetts Institute of Technology 191
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit191 a 132bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac
b 142bp NON/ShiLt
c 144bp B6.Cg-Lepob/+, C57BL/6J
d 148bp CAST/EiJ
e 166bp SPRET/EiJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit191 a 147bp A/J, AKR/J, BALB/cJ, NON/ShiLt
b 149bp DBA/2J
c 151bp B6.Cg-Lepob/+, C57BL/6J
d 159bp SPRET/EiJ
e 171bp CAST/EiJ, NOD/MrkTac
f 183bp C3H/HeJ, LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit191 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory