About   Help   FAQ
DXMit136 Primer Detail
Primers
  • Name
    DXMit136
  • Primer 1 Sequence
    ACGGAAACACTCTTATGTGCG
  • Primer 2 Sequence
    ATTTTGATTACAGCATGTCCCC
  • ID
    MGI:707019
  • Product Size
    182
  • Other IDs
    DXMit136 (BROAD)
  • Note
    MIT assay: MT3951
    Additional information: MIT STS Marker Data Files
Genes
DXMit136 DNA segment, Chr X, Massachusetts Institute of Technology 136
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit136 a 194bp 129X1/Sv
f 186bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit136 a 178bp CAST/EiJ
b 180bp SPRET/EiJ
c 186bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, NOD/MrkTac, NON/ShiLt
d 194bp LP/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory