About   Help   FAQ
DXMit170 Primer Detail
Primers
  • Name
    DXMit170
  • Primer 1 Sequence
    TGCAGGCACTAACAGTGAGG
  • Primer 2 Sequence
    TAGTTTCACTGTGCCATTGTATACA
  • ID
    MGI:706959
  • Product Size
    115
  • Other IDs
    DXMit170 (BROAD)
  • Note
    MIT assay: MTH381
    Additional information: MIT STS Marker Data Files
Genes
DXMit170 DNA segment, Chr X, Massachusetts Institute of Technology 170
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit170 a 114bp AKR/J, DBA/2J, NOD/MrkTac
b 116bp B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
c 122bp A/J, BALB/cJ, C3H/HeJ, LP/J
d 124bp CAST/EiJ
e 138bp SPRET/EiJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
DXMit170 b 110bp C57BL/6JOlaHsd, C57BL/10, SJL/J
c 116bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ
d 108bp AKR/OlaHsd, DBA/2J, JF1
p 94bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory