About   Help   FAQ
D14Mit203 Primer Detail
Primers
  • Name
    D14Mit203
  • Primer 1 Sequence
    GTTAGCCAATTTAGAGGAGAGCC
  • Primer 2 Sequence
    CAGAACTCCAGTCTAACTATCACACA
  • ID
    MGI:706946
  • Product Size
    149
  • Note
    MIT assay: MT3572
Genes
D14Mit203 DNA segment, Chr 14, Massachusetts Institute of Technology 203
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D14Mit203 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit203 a 146bp CAST/EiJ
b 156bp B6.Cg-Lepob/+
c 158bp C57BL/6J
d 164bp SPRET/EiJ
e 174bp A/J, AKR/J, BALB/cJ, NOD/MrkTac
f 176bp C3H/HeJ, DBA/2J, NON/ShiLt
g 180bp LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D14Mit203 c smaller C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit203 c 265bp CBA/CaOlaHsd
s 166bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory