About   Help   FAQ
D9Mit10 Primer Detail
Primers
  • Name
    D9Mit10
  • Primer 1 Sequence
    TAACCAACCCTTCAAGGCAC
  • Primer 2 Sequence
    AATCCTTGGCTGAAGGGAAT
  • ID
    MGI:706940
  • Product Size
    148
  • Other IDs
    D9Mit10 (BROAD)
  • Note
    MIT assay: M86
    Additional information: MIT STS Marker Data Files
Genes
D9Mit10 DNA segment, Chr 9, Massachusetts Institute of Technology 10
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D9Mit10 a largest JF1
b smaller MSM/Ms
c smaller C57BL/6
d smallest DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit10 a 75bp C57BL/6J
b 147bp DBA/2J, NON/ShiLt
c 150bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
d 156bp SPRET/EiJ
e 178bp CAST/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D9Mit10 l larger LG/J
s smaller SM/J
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory