About   Help   FAQ
D17Mit133 Primer Detail
Primers
  • Name
    D17Mit133
  • Primer 1 Sequence
    TCTGCTGTGTTCACAGGTGA
  • Primer 2 Sequence
    GCCCCTGCTAGATCTGACAG
  • ID
    MGI:706909
  • Product Size
    188
  • Other IDs
    D17Mit133 (BROAD)
  • Note
    MIT assay: MT1760
    Additional information: MIT STS Marker Data Files
Genes
D17Mit133 DNA segment, Chr 17, Massachusetts Institute of Technology 133
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit133 b larger C57BL/6J
f smaller FVB/N
J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4
Notes: Data for Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.
Endonuclease Gene Allele Fragments Strains
Not Specified D17Mit133 b 195bp C57BL/6J
s 167bp 129X1/SvJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit133 a 167bp AKR/J, BALB/cJ, C3H/HeJ, LP/J
b 173bp SPRET/EiJ
c 177bp A/J, DBA/2J, NOD/MrkTac, NON/ShiLt
d 181bp CAST/EiJ
e 195bp B6.Cg-Lepob/+, C57BL/6J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D17Mit133 b 184bp C57BL/6JOlaHsd, C57BL/10
c 158bp 129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 168bp DBA/2J
j 142bp JF1
p 186bp PWB
w 172bp A/JOlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit133 a 180bp C57BL/6W, C57BL/10W
b 170bp A.CA/W, DBA/2W
c 155bp 129/SvW, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory