D17Mit133 Primer Detail MGI Mouse MGI:706909

D17Mit133 Primer Detail

Name

D17Mit133
Primer 1 Sequence

TCTGCTGTGTTCACAGGTGA
Primer 2 Sequence

GCCCCTGCTAGATCTGACAG
ID

MGI:706909
Product Size

188
Other IDs

D17Mit133 (BROAD)
Note

MIT assay: MT1760
Additional information: MIT STS Marker Data Files

DNA segment, Chr 17, Massachusetts Institute of Technology 133

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D17Mit133	b	larger	C57BL/6J
	D17Mit133	f	smaller	FVB/N

J:46489 You Y, et al., Mamm Genome. 1998 Mar;9(3):232-4

Notes: Data for Data for C57BL/6J and BALB/cJ strains was derived from the Whitehead Institute/MIT genome center website.

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D17Mit133	b	195bp	C57BL/6J
Not Specified	D17Mit133	s	167bp	129X1/SvJ, BALB/cJ

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D17Mit133	a	167bp	AKR/J, BALB/cJ, C3H/HeJ, LP/J
	b	173bp	SPRET/EiJ
	c	177bp	A/J, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	181bp	CAST/EiJ
	e	195bp	B6.Cg-Lep^ob/+, C57BL/6J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D17Mit133	b	184bp	C57BL/6JOlaHsd, C57BL/10
	c	158bp	129P3/J, AKR/OlaHsd, BALB/cJ, C3H/HeJ, SJL/J
	d	168bp	DBA/2J
	j	142bp	JF1
	p	186bp	PWB
	w	172bp	A/JOlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D17Mit133	a	180bp	C57BL/6W, C57BL/10W
	b	170bp	A.CA/W, DBA/2W
	c	155bp	129/SvW, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:46489 You Y, et al., Utility of C57BL/6J x 129/SvJae embryonic stem cells for generating chromosomal deletions: tolerance to gamma radiation and microsatellite polymorphism. Mamm Genome. 1998 Mar;9(3):232-4

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 04/23/2024 MGI 6.23