About   Help   FAQ
D17Mit135 Primer Detail
Primers
  • Name
    D17Mit135
  • Primer 1 Sequence
    CATAGATCAGATAGTCGCACGC
  • Primer 2 Sequence
    TCTCAGGAAGGCAGGACAGT
  • ID
    MGI:706907
  • Product Size
    136
  • Note
    MIT assay: MT1720
Genes
D17Mit135 DNA segment, Chr 17, Massachusetts Institute of Technology 135
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D17Mit135 b smaller C57BL/6J
f larger FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit135 a 91bp A/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
b 137bp B6.Cg-Lepob/+, C57BL/6J
c 141bp CAST/EiJ
d 149bp AKR/J, BALB/cJ, DBA/2J, LP/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D17Mit135 a 149bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
b 137bp C57BL/6W, C57BL/10W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory