About   Help   FAQ
D17Mit139 Primer Detail
Primers
  • Name
    D17Mit139
  • Primer 1 Sequence
    AGACATGTGAGTACTGCACAGACA
  • Primer 2 Sequence
    ATGATGACATACCTCCTAGTAGTCCC
  • ID
    MGI:706903
  • Product Size
    131
  • Other IDs
    D17Mit139 (BROAD)
  • Note
    MIT assay: MT1902
    Additional information: MIT STS Marker Data Files
Genes
D17Mit139 DNA segment, Chr 17, Massachusetts Institute of Technology 139
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit139 a 136bp B6.Cg-Lepob/+, C57BL/6J
b 138bp CAST/EiJ, NOD/MrkTac
c 140bp LP/J, SPRET/EiJ
d 158bp NON/ShiLt
e 164bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D17Mit139 c larger C58/J
f not given FVB/NJ
i larger I/LnJ
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory