D15Mit211 Primer Detail MGI Mouse MGI:706896

D15Mit211 Primer Detail

Name

D15Mit211
Primer 1 Sequence

ACAAAATACACTCTACCACAATGTG
Primer 2 Sequence

CACAGTATTTAACTTTACAACACACCA
ID

MGI:706896
Product Size

125
Other IDs

D15Mit211 (BROAD)
Note

MIT assay: MJ4504
Additional information: MIT STS Marker Data Files

DNA segment, Chr 15, Massachusetts Institute of Technology 211

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit211	a	82bp	CAST/EiJ
	b	112bp	SPRET/EiJ
	c	128bp	A/J, AKR/J, B6.Cg-Lep^ob/+, LP/J, NOD/MrkTac, NON/ShiLt
	d	144bp	BALB/cJ, C3H/HeJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit211	a	144bp	BALB/cW, C3H/W, CBA/W
	D15Mit211	b	128bp	129/SvW, A.CA/W, AKR/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23