About   Help   FAQ
D15Mit11 Primer Detail
Primers
  • Name
    D15Mit11
  • Primer 1 Sequence
    TGTGAGAAAAATGACAGTAAGGC
  • Primer 2 Sequence
    TCACAGAAAGACAAGACAAAAGG
  • ID
    MGI:706879
  • Product Size
    99
  • Other IDs
    D15Mit11 (BROAD)
  • Note
    MIT assay: M237
    Additional information: MIT STS Marker Data Files
Genes
D15Mit11 DNA segment, Chr 15, Massachusetts Institute of Technology 11
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit11 a 121bp 129X1/Sv
f 106, 121bp CD-1
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D15Mit11 m 100bp MOLF/EiJ
s 110bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit11 a 94bp A/J
b 106bp B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 110bp SPRET/EiJ
d 121bp AKR/J
e 126bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory