About   Help   FAQ
D15Mit12 Primer Detail
Primers
  • Name
    D15Mit12
  • Primer 1 Sequence
    ATGGACACCTGACACTGCAA
  • Primer 2 Sequence
    AAGGGCTTTTACCTGGGAAT
  • ID
    MGI:706876
  • Product Size
    152
  • Other IDs
    D15Mit12 (BROAD)
  • Note
    MIT assay: M34
    Additional information: MIT STS Marker Data Files
Genes
D15Mit12 DNA segment, Chr 15, Massachusetts Institute of Technology 12
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D15Mit12 a 123bp CAST/EiJ
b 144bp AKR/J, SPRET/EiJ
c 150bp A/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 160bp DBA/2J
e 161bp LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D15Mit12 l smaller LG/J
s larger SM/J
J:71432 Schwarz M, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D15Mit12 a larger 129P3/J
s smaller SJL/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D15Mit12 a 160bp 129/SvW, BN/aW, DBA/2W
b 150bp A.CA/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
c 144bp AKR/W
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D15Mit12 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory