D15Mit12 Primer Detail MGI Mouse MGI:706876

D15Mit12 Primer Detail

Name

D15Mit12
Primer 1 Sequence

ATGGACACCTGACACTGCAA
Primer 2 Sequence

AAGGGCTTTTACCTGGGAAT
ID

MGI:706876
Product Size

152
Other IDs

D15Mit12 (BROAD)
Note

MIT assay: M34
Additional information: MIT STS Marker Data Files

D15Mit12

DNA segment, Chr 15, Massachusetts Institute of Technology 12

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D15Mit12	a	123bp	CAST/EiJ
	b	144bp	AKR/J, SPRET/EiJ
	c	150bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	160bp	DBA/2J
	e	161bp	LP/J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit12	l	smaller	LG/J
	D15Mit12	s	larger	SM/J

J:71432 Schwarz M, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit12	a	larger	129P3/J
	D15Mit12	s	smaller	SJL/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D15Mit12	a	160bp	129/SvW, BN/aW, DBA/2W
	b	150bp	A.CA/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	c	144bp	AKR/W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D15Mit12	c	smaller	CBA/Kw
	D15Mit12	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:71432 Schwarz M, Polymorphisms between 129P3/J and SJL/J. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23