About   Help   FAQ
D11Mit188 Primer Detail
Primers
  • Name
    D11Mit188
  • Primer 1 Sequence
    CTATTTCCTCAGTGCTCGGC
  • Primer 2 Sequence
    AGCATGTACCTTGAAAACCAGA
  • ID
    MGI:706854
  • Product Size
    126
  • Other IDs
    D11Mit188 (BROAD)
  • Note
    MIT assay: MT1405
    Additional information: MIT STS Marker Data Files
Genes
D11Mit188 DNA segment, Chr 11, Massachusetts Institute of Technology 188
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit188 a 124bp 129P1/ReJ, 129P2/Ola, 129P4/RrRkJ, 129S/SvEv, 129T1/Sv-Dnd1Ter, 129X1/Sv, 129X1/SvJ, C3HeB/FeJ
b 122bp 129P3/J
c 110kb C57BL/6J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D11Mit188 a 124bp 129X1/Sv
b 100, 126bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit188 a 100bp NOD/MrkTac
b 106bp CAST/EiJ
c 124bp AKR/J, NON/ShiLt
d 126bp A/J, BALB/cJ, C3H/HeJ, LP/J
e 128bp B6.Cg-Lepob/+, C57BL/6J
f 132bp DBA/2J
g 156bp SPRET/EiJ
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory