D11Mit185 Primer Detail MGI Mouse MGI:706851

D11Mit185 Primer Detail

Name

D11Mit185
Primer 1 Sequence

TAACATTTTTCTATCTGAAGGATGG
Primer 2 Sequence

ACAAAATGTCATCTGAAATGCG
ID

MGI:706851
Product Size

191
Other IDs

D11Mit185 (BROAD)
Note

MIT assay: MT2558
Additional information: MIT STS Marker Data Files

DNA segment, Chr 11, Massachusetts Institute of Technology 185

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit185	a	182bp	NON/ShiLt
	b	186bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	220bp	BALB/cJ, DBA/2J, LP/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit185	a	250bp	AKR/W, BALB/cW
	D11Mit185	b	186bp	129/SvW, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24