About   Help   FAQ
D11Mit180 Primer Detail
Primers
  • Name
    D11Mit180
  • Primer 1 Sequence
    ATTCCCTGGGAATTGTGAGT
  • Primer 2 Sequence
    TAGGCTCAGAAAGTCACTGCA
  • ID
    MGI:706846
  • Product Size
    150
  • Other IDs
    D11Mit180 (BROAD)
  • Note
    MIT assay: MTH175
    Additional information: MIT STS Marker Data Files
Genes
D11Mit180 DNA segment, Chr 11, Massachusetts Institute of Technology 180
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D11Mit180 a 147bp A/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 149bp AKR/J, C57BL/6J
c 151bp B6.Cg-Lepob/+, BALB/cJ
d 153bp SPRET/EiJ
e 167bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D11Mit180 c 194bp CBA/CaOlaHsd
s 193bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory