D6Mit57 Primer Detail MGI Mouse MGI:706842

D6Mit57 Primer Detail

Name

D6Mit57
Primer 1 Sequence

TCTGATATCCAAGTCATCGTGG
Primer 2 Sequence

AAACCAAACAAAAGGAGTGGC
ID

MGI:706842
Product Size

197
Other IDs

D6Mit57 (BROAD)
Note

MIT assay: MPC670
Additional information: MIT STS Marker Data Files

D6Mit57

DNA segment, Chr 6, Massachusetts Institute of Technology 57

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit57	a	196bp	129X1/Sv
Not Specified	D6Mit57	f	186, 196bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit57	a	186bp	NOD/MrkTac, NON/ShiLt
	b	192bp	SPRET/EiJ
	c	194bp	LP/J
	d	196bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J
	e	198bp	A/J, BALB/cJ
	f	200bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D6Mit57	l	smaller	LG/J
	D6Mit57	s	larger	SM/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23