About   Help   FAQ
DXMit166 Primer Detail
Primers
  • Name
    DXMit166
  • Primer 1 Sequence
    GAGATAAACCTGACTAACCCTTTCC
  • Primer 2 Sequence
    GGATTTTCCCAAAAAAGAAACC
  • ID
    MGI:706841
  • Product Size
    114
  • Other IDs
    DXMit166 (BROAD)
  • Note
    MIT assay: MT5176
    Additional information: MIT STS Marker Data Files
Genes
DXMit166 DNA segment, Chr X, Massachusetts Institute of Technology 166
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit166 a <0.122kb BALB/cJ
b 0.114kb B10.BR-H2k, B10.D2-H2d, C57BL/6
c 0.122kb BALB.K-H2k, BALB/cAnNCr, BALB/cByJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit166 a 114bp B6.Cg-Lepob/+, C57BL/6J
b 122bp BALB/cJ, CAST/EiJ
c 126bp A/J, AKR/J, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
d 128bp SPRET/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory