About   Help   FAQ
D9Mit355 Primer Detail
Primers
  • Name
    D9Mit355
  • Primer 1 Sequence
    CTCATTCACTTCCTGGTCCTG
  • Primer 2 Sequence
    GAAGGAAAGCCCACACTTTG
  • ID
    MGI:706835
  • Product Size
    121
  • Other IDs
    D9Mit355 (BROAD)
  • Note
    MIT assay: MT4649
    Additional information: MIT STS Marker Data Files
Genes
D9Mit355 DNA Segment, Chr 9, Massachusetts Institute of Technology 355
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit355 a 100bp SPRET/EiJ
b 104bp NON/ShiLt
c 121bp B6.Cg-Lepob/+, C57BL/6J
d 129bp CAST/EiJ
e 131bp A/J, BALB/cJ, C3H/HeJ, NOD/MrkTac
f 133bp AKR/J
g 135bp DBA/2J, LP/J
J:121994 Grzmil P, et al., MGI Direct Data Submission. 2007;
Endonuclease Gene Allele Fragments Strains
D9Mit355 c upper CBA/Kw
e lower KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:121994 Grzmil P, et al., STS markers on chromosome 1, 3, 5, 8 and 9 in CBXE and EXCB recombinant inbred strains of mice. MGI Direct Data Submission. 2007;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory