About   Help   FAQ
D18Mit3 Primer Detail
Primers
  • Name
    D18Mit3
  • Primer 1 Sequence
    TTCCCTATCCAGTTGTGTGC
  • Primer 2 Sequence
    AGCAGAGAATGCACCACCTC
  • ID
    MGI:706790
  • Product Size
    104
  • Other IDs
    D18Mit3 (BROAD)
  • Note
    MIT assay: L76
    Additional information: MIT STS Marker Data Files
Genes
D18Mit3 DNA segment, Chr 18, Massachusetts Institute of Technology 3
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D18Mit3 a 154bp CAST/EiJ
b 184bp AKR/J, C3H/HeJ, C57BL/6J
c 201bp A/J, DBA/2J
d 210bp B6.Cg-Lepob/+, NOD/MrkTac, SPRET/EiJ
e 215bp BALB/cJ, LP/J
J:90435 Golas A, et al., MGI Direct Data Submission. 2004;
Endonuclease Gene Allele Fragments Strains
D18Mit3 c smaller CBA/Kw
e larger KE
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory