About   Help   FAQ
D1Mit70 Primer Detail
Primers
  • Name
    D1Mit70
  • Primer 1 Sequence
    CCAAGTCAAGTCATCATATGATTT
  • Primer 2 Sequence
    CCTGTGTGCCCTGCTTAATT
  • ID
    MGI:706775
  • Product Size
    181
  • Other IDs
    D1Mit70 (BROAD)
  • Note
    MIT assay: MPC284
    Additional information: MIT STS Marker Data Files
Genes
D1Mit70 DNA segment, Chr 1, Massachusetts Institute of Technology 70
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit70 a 168bp SPRET/EiJ
b 176bp A/J, AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 180bp CAST/EiJ
d 190bp BALB/cJ, DBA/2J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit70 a 190bp BALB/cW, DBA/2W
b 176bp 129/SvW, A.CA/W, AKR, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory