About   Help   FAQ
D1Mit21 Primer Detail
Primers
  • Name
    D1Mit21
  • Primer 1 Sequence
    CGCTGGACAATCTTATAATTGCA
  • Primer 2 Sequence
    TCGAATCCCAACAACCACAT
  • ID
    MGI:706769
  • Product Size
    243
  • Other IDs
    D1Mit21 (BROAD)
  • Note
    MIT assay: D643
    Additional information: MIT STS Marker Data Files
Genes
D1Mit21 DNA segment, Chr 1, Massachusetts Institute of Technology 21
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit21 a 250bp 129X1/Sv
f 230bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit21 a 224bp SPRET/EiJ
b 230bp A/J, AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt
c 238bp CAST/EiJ
d 246bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 250bp DBA/2J, LP/J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D1Mit21 l smaller LG/J
s larger SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory