D1Mit20 Primer Detail MGI Mouse MGI:706768

D1Mit20 Primer Detail

Name

D1Mit20
Primer 1 Sequence

AGGTGAATGTACAAGTGTTTGGG
Primer 2 Sequence

TGAAATTCAGAAATCTTTCTGGG
ID

MGI:706768
Product Size

107
Other IDs

D1Mit20 (BROAD)
Note

MIT assay: A630
Additional information: MIT STS Marker Data Files

D1Mit20

DNA segment, Chr 1, Massachusetts Institute of Technology 20

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit20	c	108bp	C3HeB/FeJLe
	D1Mit20	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit20	a	102bp	CAST/EiJ
	b	108bp	A/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	110bp	AKR/J, BALB/cJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit20	l	smaller	LG/J
	D1Mit20	s	larger	SM/J

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23