About   Help   FAQ
D12Mit37 Primer Detail
Primers
  • Name
    D12Mit37
  • Primer 1 Sequence
    AAGTTTGAACACAGAACACTCAGC
  • Primer 2 Sequence
    TCTGGTTTGCAGGAAGCC
  • ID
    MGI:706762
  • Product Size
    140
  • Other IDs
    D12Mit37 (BROAD)
  • Note
    MIT assay: B318
    Additional information: MIT STS Marker Data Files
Genes
D12Mit37 DNA segment, Chr 12, Massachusetts Institute of Technology 37
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D12Mit37 m 146bp MOLF/EiJ
s 130bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit37 a 118bp A/J, BALB/cJ, C3H/HeJ
b 140bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
c 146bp CAST/EiJ, SPRET/EiJ
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D12Mit37 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D12Mit37 a 140bp AKR/W, BN/aW, C57BL/6W, C57BL/10W, DBA/2W
b 118bp 129/SvW, A.CA/W, BALB/cW, C3H/W, CBA/W
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory